2.1.

Subjects

Four hemispheres from the forebrains of two adult male rhesus monkeys (Macaca mulatta) were used in this study (M10: 6.2 kg and M37: 6.5 kg). Prior to these terminal experiments, both monkeys had participated in a series of electrophysiological and/or contrast-agent enhanced functional magnetic resonance imaging experiments unrelated to the present study.⁴⁴ All experimental procedures were approved by the regulations of the biosafety and ethical committees at KU Leuven and strictly adhered to the guidelines of the National Institutes of Health and the European guidelines for the care and use of laboratory animals.

2.2.

Vector Constructs

The recombinant AAV2 vectors used in this study were packaged in AAV1, 5, 7, 8, 9 capsids (referred to as rAAV2/1, 2/5, 2/7, 2/8 and 2/9; Table 1). Expression of enhanced green fluorescent protein (EGFP) or membrane localized cherry red fluorescent protein (mCherry) was under the control of one of four promoters: human CMV, human enhSyn1, Mus musculus CaMKIIα0.4, or Mus musculus CaMKIIα1.3. Human enhSyn1 promoter was polymerase chain reaction (PCR) amplified from a plasmid provided by Hioki et al.⁴⁵ using ATTCTAGATAGTTATTAATAGTAATCAATTACGGGG as forward and AGGATCCCGCCGCAGCGCAG as reverse primer. The MmCaMKIIα1.3 promoter was PCR amplified from plasmid 20944 (addgene) using following primers: Fw—AAAGCTAGCCATTATGGCCTTAGGTCACTTCAT and Rev— AAAAGCGCTGATATCCCGCTGCCCCCAGAACTAGGGGC. The MmCaMKIIα0.4 fragment was amplified with—AAAGCTAGCACTTGTGGACTAAGTTTGTTCACATCCC—as forward and—AAAAGCGCTGATATCGCTGCCCCCAGAACTAGGGGCCACTCG—as reverse primer. These PCR fragments were ligated in the AAV transfer plasmid using XbaI and BamHI for enhSyn1 and NheI and Eco47 III for MmCaMKIIα after the hCMV promoter was cut out.

Table 1

Overview of injected viral vectors in M10 and M37. The short solid lines separate the different injection sessions. Identical serotype/promoter injections in M10 and M37 are labelled in bold.

All vector constructs were generated by the Viral Vector Core at KU Leuven according to published procedures.³² Briefly, serum-free rAAV production was performed by triple transient transfection of HEK 293T cells (ATCC, Manassas, Virginia) using the AAV transfer plasmids, AAV rep/cap (2/1, 2/5, 2/7, 2/8, or 2/9) and pAd.DELTA.F6 plasmid in the ratio of 1:1:1 using polyethylenimine. The supernatant was harvested 5 days after transient transfection, concentrated using tangential flow filtration, and purified using an iodixanol step gradient. Gradient fractions were collected in 250 μl aliquots and fractions with refraction indices between 1.39 and 1.42 were pooled. The iodixanol of the pooled fractions was exchanged five times with phosphate-buffered saline (PBS), in a Vivaspin 6 (PES, 100,000 MWCO, Sartorius AG, Goettingen, Germany). The resulting concentrated rAAV was aliquoted and stored at $-80°\mathrm{C}$.

Genomic titers that were determined as genomic copy numbers of the respective rAAV preparations were evaluated by TaqMan-based quantitative PCR analysis using a primer probe set for the polyA sequence (primer sequences, 5′-TCTAGTTGCCAGCCATCTGTTGT-3′ and 5′-TGGGAGTGGCACCTTCCA-3′; probe sequence, 5′-TCCCCCGTGCCTTCCTTGACC–3′). Genome copies obtained for the different productions ranged from $4.0\times 10\mathrm{e}11$ to $4.8\times 10\mathrm{e}12$ genome copies/ml (Table 1).

The functional titers of rAAV2/7—CaMKIIα 0.4 and rAAV2/7—CaMKIIα 1.3 were determined as described earlier.⁴⁶ Briefly, 75.000 HEK-293T cells were incubated with a serial dilution of the respective rAAV vectors for 72 h. Following transduction, cells were washed, trypsinized, and the cell pellet was washed three more times with PBS. About 100 ng of genomic DNA was used for the determination of the rAAV genomic copies using a real-time PCR, as described earlier.³³ Each dilution of the viral vectors was used three times and this experiment was done in two different assays.

A univariate general linear model test was performed with SPSS v16.0 for Windows to compare the effects of the dilution and promoter sequence (CaMKIIα 0.4 or CaMKIIα 1.3) on the functional titers, with the assay number as a cofactor. Bonferroni posthoc tests were performed to determine specific differences between the groups. The significance level was set to $p<0.05$ for all statistical analyses.

2.3.

Vector Injections

For the cortical injections of the vector, monkeys were first sedated with Domitor and Ketalar ($50\mathrm{mg}/\mathrm{kg}$, intramuscular, Pfizer) and anesthetized with isoflurane ($\pm 1.2\%$). Postoperatively, the animals were treated with analgesics (Contramal, i.m.) and antibiotics (Kefzol, i.m). Five separate series of injections were performed, two in M10 (separated by 7 weeks) and three in M37 (separated by 6 and 3 weeks, respectively; Table 1). The time between the last series of injections and the perfusion was 4 weeks for both subjects. Four series of injections targeted area V1 and one series prefrontal cortex (area 46). Craniotomies were performed above area V1 (M10 and M37) and above frontal cortex (only in M37). After incising and partially retracting the dura mater, viral vectors were injected using a Nanoject II Auto-Nanoliter Injector (Drummond Scientific Company) attached to a custom-built micromanipulator with three translational degrees of freedom (XYZ-manipulator). Next, the vector was loaded into pulled glass micropipettes (outer diameter of $50\mu \mathrm{m}$). At each location, a total volume of 920 nL was injected at 10 equally distributed positions between the gray-white matter boundary and the pial surface (total distance of 1.8 mm) with a series of four injections of 23 nL each at a single position every 10 s and applying an interval of 2 min between consecutive vertical positions [Fig. 1(a)].

Fig. 1

Injection procedure across cortical layers. (a) Schematic representation of injection procedure. In total, 920 nL of each vector was injected across 10 equidistant positions in depth (indicated with purple dots), with a spacing of 0.18 mm perpendicular to the cortex. (b) Cortical locations of all injection sites within each craniotomy with an indication of the neighboring sulci that were visible during surgery (left and right V1 for M10, left and right V1 and right 46a for M37). Abbreviations: A, anterior; AS, arcuate sulcus; Ext. CS, external calcarine sulcus; L, lateral; LUS, lunate sulcus; M, medial; P, posterior; PS, principale sulcus; wm, white matter.

To match the vector to its corresponding position, a photo was taken and distances to main anatomical landmarks (e.g., sulci) were measured at each injection site [see Fig. 1(b) for schematic overview of the injection sites relative to sulci and the border of the respective craniotomies]. Once the viral vector injections were completed at a particular site, the dura mater was sutured, the original bone was used to cover the craniotomy, and the skin was closed over the bone flap.

2.4.

Perfusion

Four weeks after the final injection series, both monkeys were deeply anesthetized (ketalar, $50\mathrm{mg}/\mathrm{kg}$, intramuscular, Pfizer) and euthanized using an overdose of pentobarbital (intravenous, $30\mathrm{mg}/\mathrm{kg}$, Sigma). The animal was then transcardially perfused using isotonic saline [9% NaCl in 0.1 M phosphate buffer, pH 7.4 (PB)], followed by 3.5% paraformaldehyde in PB solution and finally with 5% glycerol in PB for cryoprotection. Subsequently, the brain was removed from the skull, cut in six to eight pieces and stored for 3 days in 10% and 3 days in 20% glycerol–PB solution. Tissue pieces were quickly frozen in 2-methylbutane (Merck) at $-30$ to $-40°\mathrm{C}$, stored at $-80°\mathrm{C}$, and sectioned with a cryostat at $-30°\mathrm{C}$ ($50\text{-}\mu \mathrm{m}$-thick coronal sections). The sections were stored as free-floating sections in 0.01% sodium azide containing PBS buffer (0.15 M, pH 7.4) at 4°C until further processing.

2.5.

Histology

Since the pipette tracks caused by the injections were not visible in unstained sections, a series of cryosections (every $200\mu \mathrm{m}$) were mounted onto glass plates. Cresyl violet and immunohistochemical fluorescent protein (FP) staining were then performed on two different series. Based upon the FP-staining, the injection sites could be determined as the sections with the highest proportion of FP-labeled cells across all layers. Parvalbumin (PV) and NeuN stainings were additionally performed on a series of adjacent sections to calculate the percentage of FP+ cells compared to the total number of neurons (NeuN) and to ascertain cell-type specificity (PV).

2.6.

Image Acquisition

All (immuno-)histochemically stained sections were imaged ($10\times$, $20\times$, and $40\times$ dry lenses) with a Zeiss Axio-Imager microscope equipped with Zeiss CCD Axiocam black and white and color cameras (MRc3 and MRc5, respectively). Fluorescent photographs for semiquantification were additionally acquired with an Olympus Fluoview FV1000 inverted confocal microscope ($4\times$, $10\times$, and $20\times$ objectives) and using the Olympus Fluoview acquisition software 3.0a. After defining the region of interest, the software divided this region into four to six sections and a z-stack (to cover the $50\text{-}\mu \mathrm{m}$-thick slice) was acquired.

2.7.

Proportion of Transduced Neurons

To determine the fraction of all neurons and inhibitory-specific neurons transduced for each vector, confocal images of the NeuN stainings and PV stainings were taken. To approximately define the proportion of colocalizing cells, a semiquantitative analysis (i.e., manual quantification in one section) was performed. Therefore, images were first cropped to the preferred size. Layers were then defined based on NeuN stainings and compared to neighboring CV-stained slices. Afterward, the overlap with fluorescently labeled neurons was manually scored and quantified across the different cortical layers for each image, as described in Diester et al.,³⁵ using ImageJ (image processing and analysis in Java, National Institute of Health).

When a percentage of transduced neurons is mentioned in the results, these numbers were obtained from sections adjacent to the injection site. The percentage was calculated as the number of colocalized FP+ and NeuN+ cells divided by the total number of NeuN+ cells multiplied by 100. The numbers representing the spread are based on the maximal distance from the injection site at which FP+ cells were found across the cortical surface. The anterior–posterior (A-P) axis is always mentioned first followed by the spread along the lateral–medial (L-M) axis.

3.1.

Recombinant Adeno-Associated Viral Vector Serotype-Dependent Laminar Transduction Patterns

Figures 2Fig. 3Fig. 4Fig. 5 through 6 illustrate differences in transduction efficiencies and laminar FP expression patterns in striate cortex following injection of different rAAV serotypes (2/1; 2/5; 2/7; 2/8; and 2/9) under control of the CaMKIIα0.4 promoter. Vectors used for Figs. 2, 3, 5, and 6 were injected in M37, while transduction of rAAV2/7-CaMKIIα0.4 was also tested in a second monkey (M37 and M10; Fig. 4).

Fig. 2

Transduction patterns in V1 after rAAV2/1-CaMKIIα0.4 injection. (a) Nissl stained section used to establish the borders of the cortical layers. (b) FP+ cells on an adjacent section after injection of the rAAV2/1-CaMKIIα0.4 vector in M37. (c)–(e) Enlarged views of the sectors indicated in b (c: top, d: middle, and e: bottom frame). Scale bar in panels a and $\mathrm{b}=200\mu \mathrm{m}$. Scale bar in panels c to $\mathrm{e}=50\mu \mathrm{m}$.

Fig. 3

Transduction patterns in V1 for rAAV2/5-CaMKIIα0.4. (a) and (b) Adjacent sections after injection of the rAAV2/5-CaMKIIα0.4 construct in V1 of M37. The left panel indicates the laminar pattern in V1. (b) FP+ expression profile across all layers. Expression of mCherry is detected mostly in the superficial and deeper layers (panels c and e). Weak FP+ expression was found in layer III and IV (panel d). Scale bar in panels a and $\mathrm{b}=200\mu \mathrm{m}$. Scale bar in panels c to $\mathrm{e}=50\mu \mathrm{m}$.

Fig. 4

Transduction patterns in V1 for rAAV2/7-CaMKIIα0.4. Transduction pattern after injection of the rAAV-CaMKIIα0.4 construct in V1 of M10 (top) and M37 (bottom). (a) and (f) show cresyl violet stained sections, middle (b and g) and right panels (c, d, e, g, h, I, j) show the EGFP expression in adjacent sections at low magnification and high magnification, respectively. Scale bars in left and middle $\text{panels}=200\mu \mathrm{m}$. Scale bars for $\text{right column}=50\mu \mathrm{m}$.

Fig. 5

Transduction patterns in V1 for rAAV2/8-CaMKIIα0.4. (a) Nissl-stained section of V1 from M37. (b) FP+ cells in an adjacent section after injection of the rAAV2/8-CaMKIIα0.4 vector in V1. Right panels (c, d, e), enlargements showing FP+ cells from the insets shown in b. Scale bars in left and middle $\text{panels}=200\mu \mathrm{m}$. Scale bars for $\text{right column}=50\mu \mathrm{m}$.

Fig. 6

Transduction patterns in V1 for rAAV2/9-CaMKIIα0.4. (a) Cresyl violet staining of V1 from M37. (b) EGFP+ cells from an adjacent section. (c)–(e) shows higher magnifications of the insets in panel (b). Scale bars in left and middle $\text{panels}=200\mu \mathrm{m}$. Scale bars for $\text{right column}=50\mu \mathrm{m}$.

The rAAV2/1-CaMKIIα0.4 vector resulted in a relatively focal expression pattern covering approximately $1.2\times 1.0{\mathrm{mm}}^2$ of cortex along the A-P and L-M axes. FP+ cells were observed in almost every layer of V1 near the injection site (Fig. 2). Transduction and EGFP expression after rAAV2/1-CaMK0.4 injection was stronger for infragranular and superficial cortical layers than in granular layers (Fig. 2). In particular, layers IVcα and IVcβ showed the weakest reporter activity in neurons. In addition to expression in neurons, positive glial cells were observed in the superficial layers [Fig. 2(c)].

Injection of rAAV2/5-CaMKIIα0.4 also yielded FP+ cells near the injection site, although a clearly less homogeneous expression pattern was observed across layers than with the rAAV2/1 vector [Figs. 2(b) and 3(b)]. Compared to rAAV2/1, neurons transduced by the rAAV2/5-CaMKIIα0.4 vector were found at substantially greater distances from the injection site along the A-P and L-M axes ($\sim 7.8\times 5.0\mathrm{mm}$). The greater spread was observed mainly in the deepest layers. Transduction efficiency was especially high in layers I (fibers), VI [fibers and cells; Fig. 3(e)] and at the top of layers II/III [mostly cells; Fig. 3(c)] and relatively low in the lower part of layers II/II, layers IVcα and IVcβ and the upper part of layer V. EGFP expression was also less pronounced in layers IVa and IVb (Fig. 3).

Injection of V1 with the rAAV2/7-CaMKIIα0.4 construct yielded FP+ cells mainly in the superficial and deeper layers in both monkeys (Fig. 4). The largest fraction of transduced cells was observed in layers II/III (Fig. 4, panels c and h), followed by layer V and layer VI (Fig. 4, panels e and j). Although neuropil was FP+ in layers IVb, IVc, and IVc, these layers contained relatively few FP+ cells. Hence, this vector was less than optimal for NeuN transduction in the granular layers. The rAAV2/7-CaMKIIα0.4 vector transduced cells (mostly neurons) at greater distances from the injection site compared to rAAV2/1, but the spread parallel to the cortical surface was more restricted compared to the rAAV2/5 vector [layer VI: $(2.9\pm 1.9)\times (2.8\pm 0.4)\mathrm{mm}$; ($\text{mean}\pm \mathrm{SD}$) across subjects].

Injection of rAAV2/8-CaMKIIα0.4 resulted in FP+ cells through all cortical layers, with the highest fraction in the deeper layers (Fig. 5). The spread of FP-labeled cells was rather limited along the A-P and L-M axes with a slightly wider spread in the deepest layers ($1.8\times 2.0\mathrm{mm}$). In addition, many FP-positive glial cells were detected, most notably in the granular layers, making this serotype less specific for NeuN transduction [Fig. 5(c)].

Injection of serotype rAAV2/9 with a reporter under control of the CaMKIIα0.4 promoter transduced relatively few cells in the supragranular and granular layers in contrast to infragranular layer VI (Fig. 6). The fraction of FP+ neurons was similar to the total number of transduced cells making it better for NeuN expression in comparison to rAAV2/8 but less optimal than rAAV2/7. The spreading of FP-expression induced by this vector is again rather limited (layer VI: $1.2\times 2.0{\mathrm{mm}}^2$).

Thus, when the CaMKIIα0.4 promoter is injected into monkey striate cortex, the number of cells that express the transgene in V1, the spread from the injection site, and the expression in the various cortical layers depend on the serotype.

3.2.

Promoter-Dependent Transgene Expression after rAAV2/7 Transduction

We next compared transgene expression driven by different promoters while using the same rAAV serotype. We chose the rAAV2/7 serotype because the previous test yielded a high ratio of transduced neurons in both supra- and infragranular layers and also because results of a previous mouse study using exactly the same constructs as the present study showed high transduction efficiency in area V1.²³ We injected a series of rAAV2/7 vector constructs containing the CMV, enhSyn1, CaMKIIα0.4, or CaMKIIα1.3 promoters. These rAAV2/7 constructs were injected into V1 of both animals, with the exception of enhSyn1 (M37 only).

The transduction pattern induced by the rAAV2/7-CaMKIIα0.4 vector has already been described above (Fig. 4). Surprisingly, when the longer version of the CaMKIIα promoter was used (rAAV2/7-CaMKIIα1.3), a remarkably different laminar expression pattern emerged (Fig. 7). In addition to transducing cells in layers II/III, V, and VI, as with the rAAV2/7-CaMKIIα0.4 vector, the rAAV2/7-CaMKIIα1.3 vector also strongly transduced cells in layers IVa and IVb [Figs. 7(d) and 7(i)]. Furthermore, in contrast to the short CaMKIIα0.4 promoter, hardly any FP+ neurons were found in layer IVcβ (compare Figs. 4 and 7). Overall, the long CaMKIIα promoter resulted in a more efficient transgene expression and labeled cells at greater distances from the injection site than the short promoter (A-P × L-M; layer VI: $[7.7\pm 3.2]\times [4.8\pm 2.5]$ versus $[2.9\pm 1.9]\times [2.8\pm 0.4]\mathrm{mm}$; $\text{mean}\pm \mathrm{SD}$ of both monkeys for the long versus short CaMKIIα promoter).

Fig. 7

Transduction patterns in V1 for rAAV2/7-CaMKIIα1.3. (a) and (f) Nissl-stained sections of V1 are shown for M10 (top) and M37 (bottom). (b) and (g) Transduction pattern of the rAAV2/7-CaMKIIα1.3 vector on adjacent sections. (c), (d), (e), (h, (i), (j) Higher magnified sections as indicated in the insets are shown on the right. Scale bars in left and middle $\text{panels}=200\mu \mathrm{m}$. Scale bars for $\text{right column}=50\mu \mathrm{m}$.

The rAAV2/7-CMV vector used in the present study displayed reasonable reporter levels throughout primary visual cortex (Fig. 8). Moreover, EGFP expression was lowest in layers II/III [Fig. 8(c)] and maximal in the deeper layers [Fig. 8(e)]. The majority of the EGFP+ cells after rAAV2/7-CMV injection, however, were non-neural [Fig. 8(b) inset]. In M10, only a few PF+ cells and fibers were detected and no transduced neurons could be found; hence, this monkey was not used for illustrating this vector.

Fig. 8

Transduction patterns in V1 for rAAV2/7-CMV. (a) Cresyl violet staining of V1 in M37. (b) Transduction pattern in an adjacent section after injection of V1 with the rAAV2/7-CMV vector. The inset in layer VI (panel b) shows limited overlap between FP+ labeled cells (EGFP staining; green) and neurons (NeuN-staining; magenta). (c)–(e) Higher magnification insets showing that most FP+ cells were non-neural (i.e., no overlap between NeuN and EGFP staining). Scale bars in left and middle $\text{panels}=200\mu \mathrm{m}$. Scale bars for $\text{right column}=50\mu \mathrm{m}$.

In the second monkey, we injected a vector for which the enhancer region of a CMV promoter⁵³ was fused with the human Synapsin promoter^35,54,55 (i.e., enhSyn1). This promoter in a rAAV2/7 vector yielded a relatively homogeneous transgene expression across all cortical layers (Fig. 9) and resulted in FP+ cells at larger distances from the injection site compared to the rAAV2/7-CMV vector. Furthermore, a semiquantitative analysis revealed that the fraction of FP+, non-neural cells was very low ($<2\%$) compared to the CMV promoter ($>90\%$), which renders the former vector more suited for transduction in V1.

Fig. 9

Transgene expression patterns in V1 for rAAV2/7-enhSyn1-mCherry. (a) Nissl-stained section of V1 of M37. (b) Transduction pattern of the rAAV2/7-enhSyn1 vector for an adjacent section. (c)–(e) High magnification images of the insets shown in b. Scale bars in left and middle $\text{panels}=200\mu \mathrm{m}$. Scale bars for $\text{right column}=50\mu \mathrm{m}$.

3.3.

Cell Specificity of a Long and Short Version of the CaMKIIα Promoter

Viral vectors are the most efficient means with which to transfer genetic material into the central nervous system. Specific expression of a reporter or a therapeutic protein is conditional on the combination of serotype and promoter.^17,56 Here, we tested whether the CaMKIIα promoter is specific for excitatory cells, as is generally assumed.^42,43 Therefore, we performed double stainings between FP+ cells and the inhibitory cell marker (PV), which is expressed by 75% of the inhibitory cells in primate striate cortex.⁵⁷ We calculated the number of FP+ neurons that were also PV+ after injection of two rAAV2/7 vectors driven by either a short or a long CaMKIIα promoter.

No overlap was found between FP+ and PV+ cells after injecting the rAAV2/7-CaMKIIα0.4 vector [Figs. 10(a) and 10(c)]. Surprisingly, however, injection of the rAAV2/7-CaMKIIα1.3 vector yielded double-stained cells in both monkeys, indicating that at least a fraction of the cells transduced with this CaMKIIα promoter is inhibitory in nature [Figs. 10(b) and 10(d)]. We next calculated the fraction of neurons that are both PV+ and FP+. As shown in Fig. 10(e) (pooled data, M10 and M37), the short promoter revealed no overlap between FP+ and PV+ neurons. Injections with the CaMKIIα1.3 viral vector construct resulted in $3.2\pm 0.1\%$ double-stained FP+ PV+ neurons across all the layers in V1. When considering the fraction of PV+ neurons that are also FP+ [Fig. 10(e), solid purple curve] for each layer, we found that up to 29% of the FP+ cells in layer IVcα are PV+, 17% in IVcβ, and 13% in layer V. For the other layers, the degree of overlap was below 2%. Since the highest proportion of PV+ cells is found in layer IVc,⁵⁷ this might explain why we found the highest percentage of FP+PV+ neurons in this layer. Hence, the CaMKIIα0.4 promoter is more specific for excitatory cells than the longer CaMKIIα1.3 promoter.

Fig. 10

Cell specificities of rAAV2/7-based vectors with long and short CaMKIIα promoters. (a) and (b) Transduction patterns in V1 of M10 using the rAAV2/7-CaMKIIα0.4 and rAAV2/7-CaMKIIα1.3 vectors, respectively. (c) and (d) Transduction patterns using the same vectors are shown for M37. The left column shows the EGFP signal (green), the middle column shows the results of PV-staining in magenta. The right column shows the merged EGFP- and PV stainings (white are double-stained neurons). The open white arrowheads indicate examples of nonoverlapping neurons and the filled white arrowheads indicate examples of EGFP+ −PV+ neurons. The inset in panels b and d illustrates double-stained neurons at higher magnification. (e) The plot illustrating the fraction of overlapping PV+ and EGFP+ neurons (%) for each cortical layer at the injection site for the CaMKIIα0.4 (dashed purple line with diamonds), and CaMKIIα1.3 promoters (solid purple line with squares). The blue plot represents the number of FP+ neurons for both the short (dashed line with diamonds) and long CaMKIIα (solid line with squares) promoters to illustrate the low proportion of FP+ neurons in the layers containing a high fraction of FP+ and PV+ overlapping cells. Data from both monkeys (M10 and M37) are pooled. Error bars represent SEM across monkeys ($n=2$). $\text{Scale bar}=20\mu \mathrm{m}$.

Although genomic titers were comparable between the two vectors, differences between CaMKIIα0.4 and CaMKIIα1.3 in their specificities for excitatory cells could be due to different functional titers. For this reason, the functional titers of rAAV2/7-CaMKIIα0.4 and rAAV2/7-CaMKIIα1.3 were determined by dilution assays (Fig. 11) (see also Ref. 23). The dilution of the viral vector solution influenced the measured titers ($p<0.001$) but not the genomic titer of the vector construct ($p=0.152$). Thus, because the same dilutions were injected for these vectors, differences in functional titers cannot explain the differential specificity for excitatory neurons in these two promoter sequences.

Fig. 11

Functional titers of rAAV2/7–CMV and rAAV2/7-CaMKIIα0.4. The functional titer in GC/ml was determined for three different dilutions of vector added to HEK-293T cells ($\text{black bars}=10\mu \mathrm{l}$, $\text{gray bars}=5\mu \mathrm{l}$, and $\text{white bars}=2.5\mu \mathrm{l}$ volumes). Only the volume has an effect on the functional titer. No differences exist between the serotypes. Water and nontransduced cells were added to the DNA measurements as controls. ***$p<0.001$.

3.4.

Projections to the Dorsal Lateral Geniculate Nucleus

One generally assumes that rAAV viral vectors do not transfer trans-synaptically.⁵⁸ Thus, FP+ cell bodies found at greater distances from the injection site are labeled retrogradely via transduced fibers entering the injection site. The retrograde capacity of rAAV2 vectors was previously shown by Towne et al.⁵⁹ and Zhang et al.⁶⁰ Since the dLGN is bidirectionally connected with area V1, we hypothesized that this thalamic nucleus could contain both anterogradely labeled FP+ axon terminals and retrogradely labeled FP+ cell bodies.

Figure 12 shows coronal sections of the left and right dLGN with an illustration of the retinotopic maps in panels a and b.⁶¹ Panels c and d show, respectively, EGFP+ fibers [Figs. 12(c) and 12(d)] and cells [Fig. 12(d)] in the dLGN of M10. The FP+ positive fibers in the left dLGN [Fig. 12(c); M10] must originate from the rAAV2/7-CaMKIIα0.4 vector construct, since the injection site of this vector corresponded retinotopically with the location of the FP+ signal in the dLGN and this vector construct transduced the highest proportions of neurons in left V1. In the right dLGN, we also observed FP-labeled cell bodies, which are transduced by the rAAV2/7-CaMKIIα1.3 vector [Fig. 12(d)]. Figures 12(e)–12(h) show FP+ fibers in the left and right dLGN of M37. Panels e and f reveal EGFP+ fibers, while the fibers in panels g and h are mCherry+. Since more than one of the vectors injected in each hemisphere contained the EGFP or mCherry fluorescent tag, we relied on the detailed retinotopic location of the respective injection sites in V1 and transduced fibers in the LGN to define which vector had transduced these fibers. Based on the corresponding retinotopic locations (eccentricity and polar angle) of the injection sites, we inferred that the band of fibers in panel e was transduced by the rAAV2/8-CaMKIIα0.4 vector and those in panel g by the rAAV2/5-CaMKIIα0.4 vector (approximate eccentricity and polar angle values of, respectively, 6 to 8 deg and $+15\mathrm{deg}$ and 2 to 3 deg and $+30\mathrm{deg}$). The latter vector also resulted in a relatively widespread cortical transduction pattern in layer VI of V1, which can explain the broad signal corresponding to fibers projecting to the dLGN. For the right dLGN of M37, we again used retinotopic criteria to determine that the observed EGFP+ fibers are transduced by the rAAV2/7-CaMKIIα0.4 vector [eccentricity and polar angle of 4 to 6 deg and $+15\mathrm{deg}$; Fig. 12(f)], and the mCherry+ fibers in the left dLGN by the rAAV2/7-enhSyn1 vector [eccentricity and polar angle of 4 to 6 deg and $-15\mathrm{deg}$; Fig. 12(h)]. No signal corresponding to the injection of rAAV2/1-CaMKIIα0.4, rAAV2/9-CaMKIIα0.4 and of the CMV driven vectors was found in the LGN, indicating poor anterograde and retrograde transport to this thalamic nucleus after injection of these viral vectors in V1.

Fig. 12

Retinotopic-specific antero-and retrograde transduction in dLGN after injection of rAAV vectors in V1. (a) and (b) Retinotopic map of a coronal section of the left and right LGN as determined by Malpeli and Baker⁶¹ (reprinted with permission). (c) and (d) Retinotopic-specific, anterogradely labeled fibers and retrogradely labeled cells in the LGN after injection of rAAV2/7-CaMKIIα0.4 and rAAV2/7-CaMKIIα1.3 in V1 of M10, respectively. In M37, (e) and (f) EGFP-positive fibers and (g) and (h) mCherry-positive fibers were found. The FP+ fibers in panels (e) and (g) are induced by V1 injections with the rAAV2/8-CaMKIIα0.4 and rAAV2/5-CaMKIIα0.4 vectors, respectively. In panels (f) and (h) (right LGN), the EGFP+ fibers are induced by rAAV2/7-CaMKIIα0.4 and rAAV2/7-enhSyn1 injections in V1, respectively. $\text{Scale bar}=500\mu \mathrm{m}$.

Thus, injection of rAAV2/7-CaMKIIα0.4, rAAV2/7-CaMKIIα1.3, rAAV2/7-enhSyn1, rAAV2/5-CaMKIIα0.4, and rAAV2/8-CaMKIIα0.4 in V1 resulted in anterogradely labeled FP+ axon terminals in the LGN, whereas retrogradely labeled FP+ cell bodies were found only after rAAV2/7-CaMKIIα1.3 vector injections.

3.5.

Comparison of rAAV2/7-Mediated Transduction Patterns in V1 and Dorsolateral Prefrontal Cortex

First, to determine whether the transduction efficiencies and expression patterns described in the present study are specific for V1 or are similar in different cortical areas, one vector (rAAV2/7-CaMKIIα0.4) was injected in area V1 and in the dorsolateral prefrontal cortex (area 46) of one monkey (M37). Transduction was more homogeneous across all layers of area 46 compared to V1 (Fig. 13), but the area of lateromedial spread in layer VI was half of that in area 46 (2.4 mm versus 5.0 mm). The anteroposterior spread, however, was equal in the two areas (3.0 mm).

Fig. 13

Comparison of transduction patterns in V1 and prefrontal cortex. (a) and (b) Transduction pattern of rAAV2/7-CaMKIIα0.4 in the dorsolateral prefrontal cortex and in the primary visual cortex. The left images show the FP+ cells. The figures on the right are the corresponding photographs of Nissl staining. Scale bar is $200\mu \mathrm{m}$.

3.6.

Comparison of Cytomegalovirus-Mediated Transduction Patterns in V1 and Dorsolateral Prefrontal Cortex

Finally, to confirm that the absence of FP+ neurons after injection of the CMV-promoter-driven constructs is not restricted to V1, the same vectors were also injected into area 46. All injected CMV- constructs (rAAV2/1-CMV, rAAV2/8-CMV and rAAV2/9-CMV) failed to show transgene expression in prefrontal cortical neurons in macaque neocortex.

4.1.

Transduction Efficiencies are Serotype Dependent

Primate cortical neurons were successfully transduced with rAAV2/1, rAAV2/5, rAAV2/7, rAAV2/8, and rAAV2/9. Earlier reports by Markakis³⁹ and Dodiya⁴¹ showed variations in the number of macaque neurons transduced depending on the serotype used. In these previous reports, rAAV2/1 and rAAV2/5 proved the most efficient vectors. They transduced a large number of cells in the basal ganglia, striatum, and substantia nigra (SN) of the primate brain. Other studies with injections in the SN of rats reported higher transduced brain volumes using rAAV2/7, rAAV2/9, and rAAV2/1 than with rAAV2/8 and rAAV2/5, indicating species-dependent transduction efficiencies of the viral vectors.^30,33,62 In our study, the rAAV2/1-CaMKIIα0.4 showed efficient transduction at the injection site but the transgene expression pattern was limited to about $1.2\times 1.0{\mathrm{mm}}^2$. This corroborates a recent report by Jazayeri et al.⁵⁴ in which the rAAV2/1 vector, including the hSyn promoter, was injected into this same cortical area. These authors reported a small band of ChR2-positive cells at the injection site, with only a few transduced neurons 1 mm away. Furthermore, despite uniform injection throughout the cortical depth, they also found layer-specific expression of the gene-of-interest, possibly due to the characteristic tropism of the rAAV2/1 vector.⁵⁴

Vector rAAV2/5 has been reported to disperse further from the injection site in both mice and primates.^23,32,35,63 Also in the present study, rAAV2/5-CaMKIIα0.4 injections resulted in the most widespread ($7.8\times 5.0{\mathrm{mm}}^2$) transduction across layers II/III, V, and VI. Other serotypes, such as rAAV2/7, showed a spread of $(2.9\pm 1.9)\times (2.8\pm 0.4)\mathrm{mm}$ (i.e., mean of both monkeys ± SD), while rAAV2/8 and rAAV2/9 showed smaller spreads [$(1.8\times 2.0)$ and $(1.2\times 2.0)\mathrm{mm}$, respectively]. We summarized the results of our semiquantitative comparisons in Fig. 14 and ranked the AAV serotypes containing the CaMKIIα0.4-promoter by transduction efficiency based on the cortical spread: rAAV2/5>>rAAV2/7>rAAV2/8>rAAV2/9>>rAAV2/1. This ranking differs only for rAAV2/8 and rAAV2/9 from that reported for mouse visual cortex using exactly the same vector batches (rAAV2/5 >> 2/7 ≥ 2/9 ≥ 2/8 >> 2/1),²³ but more substantially with regard to primate SN, striatum, and basal ganglia (rAAV2/5 ≥ rAAV2/1 > rAAV2/8^39,41).

Fig. 14

Semiquantitative summary of the transduction results in M10 and M37. This figure shows a semiquantitative overview of the results (the spread along the cortical surface and fraction of FP+ neurons) for each injected vector in the primary visual cortex (M10 and M37) and dorsolateral prefrontal cortex (M37). Columns 4 and 5 illustrate the spread of FP-labeled cells (black bars) along the anterior–posterior axis (A-P) and lateral–medial axis (L-M), respectively. Column 5 represents the product of columns 3 and 4 (two-dimensional spread). Column 6 shows the percentage of EGFP+ neurons at the injection site ($300\mu \mathrm{m}$ in L-M direction) for individual layers. Column “PV+” shows the percentage of parvalbumine-positive labeled EGFP+ neurons. The last column (LGN) shows anterograde (A)- or retrograde (R) transduction capability in the LGN as a result of vector injections in V1. Numbers between brackets correspond to the mean values across monkeys (when available).

Additionally, for the percentages of transduced neurons at injection sites, we could rank the rAAV serotypes as follows: rAAV2/1>rAAV2/5>rAAV2/7=rAAV2/9>rAAV2/8. When aiming for an rAAV serotype with a high percentage of transduced cells at the injection site and a widely spread transduction, the ranking is as follows: rAAV2/5 > rAAV2/7 > rAAV2/1 > rAAV2/8 = rAAV2/9 (see Fig. 14).

4.2.

Promoter-Dependent Transgene Expression Levels

The serotype of the vector determines which cells can be transduced by the viral particles. Furthermore, the promoter should also be active in expressing the reporter protein in these cells. Thus, the combination of serotype and promoter determines the transduction pattern. Despite the widespread use of the CMV promoter in rodents,^{32,33,64–66} we were unable to transduce neurons efficiently with rAAV carrying the CMV promoter in primate cortical neurons, in both visual and prefrontal cortices. Recently, Watakabe et al.¹⁸ reported neural toxicity caused by the CMV promoter when survival time after injections exceeded 21 days (in our case between 29 and 93 days). In line with this study, we also found more than 90% of the transgene expression driven by rAAV2/7 CMV in glial cells instead of neurons.

In contrast to results with the CMV promoter, the human synapsin-1 promoter^11,35,55 combined with the enhancer elements of the CMV promoter (enhSyn1) yielded a homogenous expression pattern across all cortical layers. The hSyn1 promoter sequence efficiently recruits TFs in monkey neurons based on the high expression levels driven by the enhSyn1 promoter in these cells. In rodents, NeuN TFs have been shown to have a high affinity for the hSyn1 promoter.^63,64 Adding the CMV enhancer sequence (enhSyn1) additionally improves the neuron-specific transcriptional activity of the hSyn1 promoter, in line with previous reports.^67,68

Another surprising finding was the different transduction patterns induced by two highly similar viral vector constructs consisting of different lengths (364 bp and 1291 bp) of the CaMKIIα promoter. We found that in V1, the short 0.4 kb CaMKIIα-promoter transduces neurons in all layers, with the least efficiency in layers IVb and IVcα. The long version CaMKIIα-promoter selectively transduced cells in all cortical layers, however, few neurons in layer IVcα and IVcβ. Thus, the main distinction between the transduction efficiencies of these two versions of the CaMKIIα promoters can be found in the granular layers. The laminar expression of CaMKIIα mRNA in primate V1 has been well described ^69–71 but fails to explain the differences we observed between the transduction patterns of the two versions of the CaMKIIα promoters used in this study. For instance, layer IVb is almost void of CaMKIIα mRNA signal,^69,71 which fits with the low number of transduced cells in layer IVb using the CaMKIIα0.4 promoter but not with the reasonably high transduction levels using the CaMKIIα1.3 promoter. Based on the lack of expression in specific layers using the CaMKIIα1.3 promoter, we speculate that factors that can inhibit transcription, such as specific miRNAs, may bind to the extra fragments in the longer version of the CaMKIIα promoter. Conversely, higher expression levels induced by the CaMKIIα0.4 promoter may result from the loss of this inhibitory regulation. Irrespective of the reasons for transductional disparities between the short and long CaMKIIα promoters, the former is more specific for excitatory cells when used in combination with AAV.

Other than the specific laminar expression patterns of the two CaMKIIα-promoters, differences in cell specificity were also observed. The rAAV2/7-CaMKIIα0.4 vector resulted in transgene expression exclusively in excitatory neurons while, somewhat surprisingly, rAAV2/7-CaMKIIα1.3 also drove expression in a small proportion of V1 PV-positive cells. Despite the relatively small fraction of PV+FP+ neurons across the cortical depth as a whole, in some layers (e.g., IVcα) almost one third of the transduced neurons were inhibitory in nature. The latter results are contrary to findings in most nonhuman primate^42,43 and rodent studies,^49,51,52,72 where selective expression in excitatory cells was reported when the CaMKIIα promoter is used. A study by Nathanson et al.⁴⁶ already showed the lack of specificity of the CaMKIIα promoter when used in an AAV vector, and recent results in mice have confirmed this finding.⁵⁰ Furthermore, these authors reported that the specificity of lentiviral vectors with the CaMKIIα promoter is largely due to the tropism of the lentivirus, in which the CaMKIIα can provide additional selectivity. Also in line with our results, the fugu-derived CaMKIIα promoter in an rAAV2/1 vector drives expression in a small fraction of inhibitory neurons.⁷³ In that study, the percentage of excitatory positive-labeled cells was much higher, exactly as in the present study.

4.3.

Retrogradely Transduced Cells

Previous studies showed that rAAVs can transduce cells retrogradely in nonhuman primates^39,58,74,75 and rodents.^{30,32,76–79} We confirmed this observation by showing EGFP-labeled cell bodies in the dLGN at locations corresponding retinotopically to the V1 injection sites of the rAAV2/7-CaMKIIα1.3 vector. The degree of retrograde labeling was rather low. Injections of the rAAV2/7-CaMKIIα0.4, rAAV2/5-CaMKIIα0.4, rAAV2/8-CaMKIIα0.4, and rAAV2/7-enhSyn1 vectors in V1 resulted only in anterogradely FP-labeled axons in retinotopically matching regions of the dLGN. The differences in retro-and anterograde transduction capacities in the dLGN may be related to the laminar variations in transduction observed in area V1 using the various vectors in the present study. Thalamocortical axons terminate mainly in layer IV;⁸⁰ hence, good transduction of that layer should be required for optimal retrograde labeling in the LGN. Conversely, feedback from V1 to the LGN mainly originates in layer VI; thus, efficient transduction in the deepest layer after V1 injections must be a prerequisite for good anterograde labeling in the thalamus.

4.4.

Transduction Efficiencies are Area Dependent

We found laminar differences in the transduction patterns in two neocortical areas (V1 and prefrontal cortex) of the same monkey, even when injecting the same viral vector (Fig. 13). Hence, as expected, the transduction pattern of rAAV vectors also depends on the targeted area. This suggestion is corroborated by the apparent discrepancy between our results and those obtained in primate SN using the same serotype.³⁰ The lack of FP+ neurons after injecting a CMV construct, however, was observed in the two neocortical areas. This could indicate that the aforementioned neural toxicity caused by CMV-driven constructs affects all cortical regions.

4.5.

Limitations